circad | circRNAs associated with diseases

circ_104075
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	30361504
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Ten pairs of tumor and adjacent liver tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAAGATGTCAAGCCCTTTAGC Reverse GAGTTGCTTAGCTTTCATTTGTC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, X, Xu, Y, Qian, Z, Zheng, W, Wu, Q, Chen, Y, Zhu, G, Liu, Y, Bian, Z, Xu, W, Zhang, Y, Sun, F, Pan, Q, Wang, J, Du, L, Yu, Y (2018). circRNA_104075 stimulates YAP-dependent tumorigenesis through the regulation of HNF4a and may serve as a diagnostic marker in hepatocellular carcinoma. Cell Death Dis, 9, 11:1091.