Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_104075 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
DBLink | Link to database | PMID | 30361504 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Ten pairs of tumor and adjacent liver tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GAAGATGTCAAGCCCTTTAGC ReverseGAGTTGCTTAGCTTTCATTTGTC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zhang, X, Xu, Y, Qian, Z, Zheng, W, Wu, Q, Chen, Y, Zhu, G, Liu, Y, Bian, Z, Xu, W, Zhang, Y, Sun, F, Pan, Q, Wang, J, Du, L, Yu, Y (2018). circRNA_104075 stimulates YAP-dependent tumorigenesis through the regulation of HNF4a and may serve as a diagnostic marker in hepatocellular carcinoma. Cell Death Dis, 9, 11:1091. |